Files and links (1)
Liu_Dong_19978.70 MB
PDF Restricted Access, VIEWABLE UPON REQUEST: contact archives@drexel.edu
Dissertation
Microtubule-associated protein 1B (MAP1B) gene expression in the nervous system: characterization of the gene promoter and the molecular mechanism regulating its transcription
Doctor of Philosophy (Ph.D.), Allegheny University of the Health Sciences
Jan 1997
DOI:
https://doi.org/10.17918/00008622
Abstract
Microtubule-associated protein 1B (MAP1B) is an major constituent of the neuronal cytoskeleton that is highly expressed during early development of the nervous system and plays a role in axonal growth. To study the regulation of MAP1B transcription we have isolated genomic clones containing up to 11 kb of the upstream region of the rat MAP1B gene, sequenced about 1.8 kb of the proximal promoter region and identified several consensus elements and inverted repeats. S1 nuclease and RNase protection assays identified two groups of transcription initiation sites corresponding to two TATA boxes that were utilized differentially in distinct regions of the nervous system during development. Transient transfection assays demonstrated that two DNA fragments of 229 bp and 127 bp, each containing a TATA box and its adjacent region, could independently direct neuron-specific expression of a reporter gene using the in vivo initiation sites. Structural analysis identified a DNase I hypersensitive site at the proximal promoter region that appears to be specific to brain. Fine mapping with S1 nuclease sensitivity assay detected two adjacent sites in the same region. Electrophoresis mobility shift assay showed that two consensus elements present in the proximal promoter region, Sp1 and CRE, had strong binding activity with all nuclear extracts. In contrast, two previously identified common sequences, a neuronal motif (TGGAGGAGTGGAGGCAGCCACCACGAG) and a TCC repeat motif, showed a much weaker binding activity with brain nuclear extract relative to other tissue. These results suggest that two alternative promoters regulate the temporal and tissue-specific expression of the rat MAP1B gene. This expression pattern is regulated by the active chromatin structure in the proximal promoter region and the interaction of specific nuclear factors with positive and negative control elements in this region. Finally, several founder lines of transgenic mice were generated with two constructs of the MAP1B promoter-LacZ gene that will be used to further study the in vivo function of the MAP1B promoter during normal development and nerve regeneration after injury.
Metrics
9 Record Views
Details
- Title
- Microtubule-associated protein 1B (MAP1B) gene expression in the nervous system
- Creators
- Dong Liu
- Contributors
- Itzhak Fischer (Advisor) - Drexel University, Allegheny University of the Health Sciences (1996-1998)
- Awarding Institution
- Allegheny University of the Health Sciences
- Degree Awarded
- Doctor of Philosophy (Ph.D.)
- Publisher
- Allegheny University of the Health Sciences; Philadelphia, Pennsylvania
- Number of pages
- xiii, 225 pages
- Resource Type
- Dissertation
- Language
- English
- Academic Unit
- Anatomy (and Neurobiology) [Historical]; Allegheny University of the Health Sciences (1996-1998); School of Medicine (1996-1998)
- Other Identifier
- 991021889010504721